Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU053261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rapgef3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTCTTTGAACCACACAGCAAGGCAGGAACTGTGTTGTTCAGCCAGGGGGACAAGGGTACCTCGTGGTACATTATCTGGAAGGGATCTGTCAATGTGGTGACCCATGGCAAGGGGCTGGTGACCACGTTGCACGAGGGAGATGACTTTGGACAGCTGGCTCTGGTGAACGACGCACCTCGGGCAGCCACCATCATCCTTCGAGAAAATAACTGTCACTTTCTGCGTGTGGACAAGCAGGACTTCAACCGCATCATCAAGGATGTGGAAGCAAAAACCATGAGACTGGAAGAACACGGCAAAGTGGTCTTAGTTCTGGAGAGAACCTCTCAGGGTGCTGGCCCTTCCCGTCCCCCGACCCCAGGCAGGAACCGGTATACGGTCATGTCTGGCACCCCAGAGAAAATCCTAGAACTGCTGTTGGAGGCTATGAGACCGGATTCCAGTGCTCATGACCCAACAG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
Supachoke Mangmool et al.
Molecular endocrinology (Baltimore, Md.), 29(4), 583-596 (2015-02-27)
Although the cardioprotective effects of glucagon-like peptide-1 and its analogs have been reported, the exact mechanisms of the glucagon-like peptide-1 receptor (GLP-1R) signaling pathway in the heart are still unclear. Activation of the GLP-1R has been shown to increase cAMP
Ke Ke et al.
PloS one, 10(5), e0124869-e0124869 (2015-05-21)
Cilostazol has been reported to alleviate the metabolic syndrome induced by increased intracellular adenosine 3',5'-cyclic monophosphate (cAMP) levels, which is also associated with osteoclast (OC) differentiation. We hypothesized that bone loss might be attenuated via an action on OC by
Pablo Muñoz-Llancao et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(32), 11315-11329 (2015-08-14)
Acquisition of neuronal polarity is a complex process involving cellular and molecular events. The second messenger cAMP is involved in axonal specification through activation of protein kinase A. However, an alternative cAMP-dependent mechanism involves the exchange protein directly activated by

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica