Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU052671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Msi1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCCAAGGTGGCCTTTCCTCGAAGAGCACAGCCTAAGATGGTCACTCGGACGAAGAAGATCTTCGTGGGGGGGCTGTCTGTGAACACCACGGTGGAAGATGTGAAACACTATTTCGAGCAGTTCGGAAAGGTGGATGATGCCATGCTGATGTTCGACAAAACCACCAACAGGCACAGAGGGTTTGGATTTGTCACGTTTGAGAGCGAGGACATCGTAGAGAAAGTTTGTGAGATCCACTTCCATGAAATCAACAACAAAATGGTGGAATGCAAGAAAGCCCAGCCAAAGGAGGTGATGTCCCCGACAGGCTCAGCCCGGGGCAGGTCTCGGGTCATGCCCTACGGAATGGATGCCTTCATGCTGGGTAT

Ensembl | Número de adesão de camundongo

ENSMUSG00000054256

nº de adesão NCBI

NM_008629

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... MSI1(17690) , Msi1(17690)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mitzli X Velasco et al.
RNA (New York, N.Y.), 25(7), 768-782 (2019-04-21)
RNA-binding proteins (RBPs) and miRNAs are critical gene expression regulators that interact with one another in cooperative and antagonistic fashions. We identified Musashi1 (Msi1) and miR-137 as regulators of a molecular switch between self-renewal and differentiation. Msi1 and miR-137 have
In-Sun Hong et al.
PloS one, 8(2), e56496-e56496 (2013-02-19)
Human umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are essential tools for regenerative medicine due to their capacity for self-renewal and multi-lineage differentiation. As MSCs are found in very small numbers in various tissues, in vitro cell expansion is
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica