Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU047431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGAAGCGAAGATCCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAAGCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGAGGCCCAGGAGTCAGGGTTATTCTTTGGCTAATGGGGAGTTTAAGGAAAGAGGCATCAATCTGCAGAGTGGAGAAAGTGGGGGTAAGGGTGGGTTGCGTGGGTAGCTTGCACTGCCGTGTCTCAGGCCGGGGTTCCCAGTGTCACCCTGTCTTTCCTTGGAGGGAAGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000050966

nº de adesão NCBI

NM_145833

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... LIN28(83557) , Lin28(83557)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
AOR
QCS
XWR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wensen Ding et al.
International journal of clinical and experimental pathology, 13(5), 1136-1145 (2020-06-09)
As an evolutionarily conserved RNA-binding protein, LIN28 is known to be involved in the regulation of the translation and stability of a large number of mRNAs and the biogenesis of certain miRNAs. Increasing evidence indicates that LIN28 regulates many cellular
Qian Li et al.
Experimental cell research, 388(1), 111718-111718 (2019-12-25)
Successful implantation happens only when the development of a competent blastocyst synchronized with the differentiation of a receptive uterus. The exact mechanism affecting embryo implantation competency is still unclear. Previous data from our laboratory showed that several members of the
Jinzhuo Dou et al.
Molecular oncology, 14(9), 2288-2312 (2020-04-26)
LIN28A is a conserved RNA-binding protein that inhibits the biogenesis of let-7 microRNAs, thus promoting cancer progression. However, mechanisms underlying the activation of the LIN28A-let-7 signaling pathway remain poorly understood. Here, we show that LIN28A is SUMOylated in vivo and in vitro

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica