Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU046811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atox1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGTGCCGCGTCAGTCATGCCGAAGCACGAGTTCTCCGTGGACATGACCTGTGAGGGCTGTGCTGAAGCCGTCTCCAGAGTCCTCAACAAGCTGGGAGGAGTGGAGTTCAACATTGACCTGCCCAACAAGAAGGTCTGCATCGACTCTGAGCACAGCTCAGACACCCTGCTGGCAACCCTCAACAAAACAGGAAAGGCTGTTTCCTACCTTGGCCCCAAGTAGCCAGGACCTGGGCGAGTCCTTCCGGATATAAACTGAAGAGGCAGGCTGTTGATCTGGTCTCCCCGGCAGATCTGGAACACCAACTGCTCAGTCCAGTCCAGCCCAGCCATGGAGTTCCTGCCCAGACAGGCCTTCCCCGCTGGCTCCCTGCAAGCTTCCATGTAATAAAGTCAAGCTGAGTTT

Ensembl | Número de adesão de camundongo

ENSMUSG00000018585

nº de adesão NCBI

NM_009720

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ATOX1(11927) , Atox1(11927)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Huawei Cai et al.
Oncology reports, 30(1), 269-275 (2013-04-30)
Copper is required for cell proliferation and tumor angiogenesis. Cellular copper metabolism is regulated by a network of copper transporters and chaperones. Antioxidant-1 (ATOX1) is a cytosolic copper chaperone important for intracellular copper transport, which plays a role in the
Gin-Fu Chen et al.
Scientific reports, 5, 14780-14780 (2015-10-07)
Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and
Arundhati Jana et al.
PloS one, 15(1), e0227916-e0227916 (2020-01-22)
Colorectal cancer remains a deadly cancer due to metastatic disease. To understand the molecular mechanisms of metastasis in colon cancer, we investigated whether the copper chaperone antioxidant-1 (Atox1) protein plays a role in this process. Recent findings indicate that Atox1
Edward A Ratovitski
Current pharmaceutical biotechnology, 16(9), 832-850 (2015-06-20)
MicroRNAs, whose transcription is regulated by members of the tumor protein p53 family, modulate the expression of numerous metabolic enzymes, significantly altering tumor cell response to chemotherapeutic treatments. The role for ΔNp63α-regulated microRNAs in regulation of cell cycle arrest, apoptosis

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica