Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU045141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGGTGTGGGTCAGGAAATCACATCTTATACCGCTCGAGAGCCGGACACGTTCATGGATCAGAAGATCACGTATCGGATTTGGAGGGACACTGCCAACTGGCTGGAGATTAACCCAGAGACTGGTGCCATTTTCACGCGCGCTGAGATGGACAGAGAAGACGCTGAGCATGTGAAGAACAGCACATATGTAGCTCTCATCATCGCCACAGATGATGGTTCACCCATTGCCACTGGCACGGGCACTCTTCTCCTGGTCCTGTTAGACGTCAATGACAACGCTCCCATCCCAGAACCTCGAAACATGCAGTTCTGCCAGAGGAACCCACAGCCTCATATCATCACCATCTTGGATCCAGACCTTCCCCCCAACACGTCCCCCTTTACTGCTGAGCTAACCCATGGGGCCAGCGTCAACTGGACCATTGAGTATAATGACGCAGCTCAAGAATCTCTCATTTTGCAACCAAGAAAGGACTTAGAGATTGGCGAATACAAAATCCATCTCAAGCTCGCGGATAACCAGAACAAAGACCAGGTGACCACGTTGGACGTCCATGTGTGTGACTGTGAAGGGACGGTCAAC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica