Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU044851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arhgap24

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAGCGGAATTTGACTTTGGAAACGGAAATGCTGAGCCTCCATGACGAACTGGATCAAGAGAGGAAAAAGTTCACCATGATAGAAATCAAGATGAGAAACGCTGAGCGCGCAAAGGAGGATGCGGAGAAAAGGAACGACATGCTCCAGAAGGAGATGGAGCAGTTCTTCTCCACATTTGGAGACCTGACAGTGGAACCCAGGAGAAGCGAGAGAGGAAACACAATCTGGATCCAGTGAGCCTTTCTCTGTCCTGGACCGCTCGCTCCGCGGAGGACTCTGGGGACTCCGGGGCAAACAGTGTTGGGGAACAGGTGTGGGATCAGGTGGTTGGTCTGTGTAGAGCTTCATCTGGTGCAGGAATCTCATTTCCAGACATCACTATCCATATCTGCAGTGTGTACCAAAGTTATATCATGCTCCATAATGCTACTGTCAAGTGTTACAACTGGATATGTGTATAGAGAGTAGTTTCTAAGATGTCAATAAGAGTAAGAAGCATATATCTCAATGATTATTTTATTGCAAGTCCTGTATTTAAATGTCGAATCAATACTTTGTTGCAATTTAGCTTGCA

Ensembl | Número de adesão de camundongo

ENSMUSG00000057315

nº de adesão NCBI

NP_666273

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ARHGAP24(231532) , Arhgap24(231532)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Flaviana Marzano et al.
Molecular biology of the cell, 26(15), 2733-2741 (2015-06-13)
The regulation of insulin-like growth factor-binding protein 3 (IGFBP3) gene expression is complex, because it can be induced by agents that both stimulate and inhibit the proliferation. The principal aim of this study was to investigate whether p73, a member
Eva Tonsing-Carter et al.
Molecular cancer therapeutics, 14(12), 2850-2863 (2015-10-24)
Triple-negative breast cancers (TNBC) are typically resistant to treatment, and strategies that build upon frontline therapy are needed. Targeting the murine double minute 2 (Mdm2) protein is an attractive approach, as Mdm2 levels are elevated in many therapy-refractive breast cancers.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica