Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU044291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Antxr1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGCTTGCTACGGAGGATTCGACCTCTACTTCATCCTGGACAAGTCAGGAAGTGTGCTGCACCACTGGAATGAAATCTACTACTTCGTGGAGCAGTTGGCTCATAGATTCATCAGCCCACAGCTAAGGATGTCCTTCATTGTCTTCTCTACTCGAGGGACAACTTTAATGAAACTAACTGAGGACAGGGAACAGATCCGACAAGGCCTAGAAGAGCTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCACGAAGGATTCGAGAGGGCCAGTGAGCAGATTTACTATGAGAACAGTCAAGGATACAGGACGGCGAGCGTCATCATCGCGTTGACGGATGGGGAGCTGCACGAGGACCTCTTCTTCTACTCAGAGAGGGAGGCTAACCGATCCCGAGACCTTGGTGCGATTGTTTACTGCGTTGGCGTGAAGGATTTCAATGAAACTCAGTTGGCTCGGATTGCAGACAGTAAGGACCACGTGTTTCCTGTGAACGACGGCTTCCAGGCTCTCCAAGGCATTATCCACTCAATTTTAAAGAAATCCTGCATCGAAATTCTGG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Maude Gabriel et al.
BMC cancer, 15, 227-227 (2015-04-18)
Modification of splicing by chemotherapeutic drugs has usually been evaluated on a limited number of pre-mRNAs selected for their recognized or potential importance in cell proliferation or apoptosis. However, the pathways linking splicing alterations to the efficiency of cancer therapy

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica