Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU043861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAGAAGGCTGTGTTCTTCGCAGGGAATGAGTACTGGGTCTATTCTGCTAGTACTCTGGAGCGAGGATACCCCAAGCCACTGACCAGCCTGGGGTTGCCCCCTGATGTCCAGCAAGTAGATGCTGCCTTTAACTGGAGTAAGAACAAGAAGACATACATCTTTGCAGGAGACAAGTTCTGGAGATACAATGAAGTGAAGAAGAAAATGGACCCCGGTTTCCCTAAGCTCATCGCAGACTCCTGGAATGCCATCCCTGATAACCTGGATGCCGTCGTGGACCTGCAGGGTGGTGGTCATAGCTACTTCTTCAAGGGTGCTTATTACCTGAAGCTGGAGAACCAAAGTCTCAAGAGCGTGAAGTTTGGAAGCATCAAATCAGACTGGCTGGGCTGCTGAGCTGGCCCTGTTCCCACGGGCCCTATCATCTTCATCGCTGCACACCAGGTGAAGGATGTGAAGCAGCCTGGCGGCTCTGTCCTCCTCTGTAGTTAACCAGCCTTCTCCTTCACCTGGTGACTTCAGATTTAAGAGGGTGGCTTCTTTTTGTGCCCAAAG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yijing Chu et al.
Experimental cell research, 337(1), 16-27 (2015-07-26)
Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal
Eric A Voll et al.
Oncotarget, 5(9), 2648-2663 (2014-05-07)
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27)
Irina Gradinaru et al.
PloS one, 10(11), e0142787-e0142787 (2015-11-17)
α1a Adrenergic receptors (α1aARs) are the predominant AR subtype in human vascular smooth muscle cells (SMCs). α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular
Suping Yang et al.
Molecular medicine reports, 12(5), 6990-6996 (2015-09-10)
Prostate cancer (PCa) is the second leading cause of cancer‑related mortality among American males. Studies suggest that cigarette smoking is associated with the progression of PCa; however, the molecular mechanisms underlying this process have not been extensively investigated. PCa progression

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica