Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU034351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd34

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em29 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em29 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGTAGCTCTCTGCCTGATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCATCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACTTGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTCTGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTGCCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTTCTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGCTTACACATCATCTTCTGCTCCGAGTGCCATTAAGGGAGAAATCAAATGCTCTGGAATCCG

Ensembl | Número de adesão de camundongo

ENSMUSG00000016494

nº de adesão NCBI

NM_133654

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CD34(12490) , Cd34(12490)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jun-Feng Liu et al.
Experimental and therapeutic medicine, 8(3), 805-812 (2014-08-15)
The number and function of endothelial progenitor cells (EPCs) may be a predictive factor for the severity and outcome of cardiovascular disease. However, the manipulation of bone marrow mononuclear cell (BMMC) cultures for EPCs is an elaborate and difficult procedure
Tunay Kökten et al.
PloS one, 9(1), e86011-e86011 (2014-01-28)
The sensory innervation of the dental mesenchyme is essential for tooth function and protection. Sensory innervation of the dental pulp is mediated by axons originating from the trigeminal ganglia and is strictly regulated in time. Teeth can develop from cultured
Rifat Jan et al.
Breast cancer research : BCR, 14(6), R146-R146 (2012-11-16)
Despite the benefits of endocrine therapies such as tamoxifen and aromatase inhibitors in treating estrogen receptor (ER) alpha-positive breast cancer, many tumors eventually become resistant. The molecular mechanisms governing resistance remain largely unknown. Pigment epithelium-derived factor (PEDF) is a multifunctional
Princess I Imoukhuede et al.
PloS one, 7(9), e44791-e44791 (2012-09-18)
VEGFR surface localization plays a critical role in converting extracellular VEGF signaling towards angiogenic outcomes, and the quantitative characterization of these parameters is critical for advancing computational models; however the levels of these receptors on blood vessels is currently unknown.
Luisa Boldrin et al.
PLoS currents, 3, RRN1294-RRN1294 (2012-02-16)
Satellite cells, normally quiescent underneath the myofibre basal lamina, are skeletal muscle stem cells responsible for postnatal muscle growth, repair and regeneration. Since their scarcity and small size have limited study on transverse muscle sections, techniques to isolate individual myofibres
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica