Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU034161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bst2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAATCTACTTCGCCGTCACAGCGAACAGCGTGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCTCACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACCCTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGAATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCAGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTTTGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTCCTGGCAGCCCTGAGGATGTGGAAACCACTAGGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000046718

nº de adesão NCBI

NM_198095

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... BST2(69550) , Bst2(69550)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Sebastian Giese et al.
PLoS pathogens, 10(7), e1004189-e1004189 (2014-07-06)
Bst-2/Tetherin inhibits the release of HIV by tethering newly formed virus particles to the plasma membrane of infected cells. Although the mechanisms of Tetherin-mediated restriction are increasingly well understood, the biological relevance of this restriction in the natural target cells
Jaraspim Narkpuk et al.
Biochemical and biophysical research communications, 450(4), 1469-1474 (2014-07-16)
While viral inhibition by tethering of budding virions to host cell membranes has been focused upon as one of the main functions of BST-2/tetherin, BST-2 is thought to possess other functions as well. Overexpression of BST-2 was found here to

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica