Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU219141

Sigma-Aldrich

MISSION® esiRNA

targeting human UGT1A3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 2.976,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 2.976,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCATTGGGGGCATCAACTGTGCCAACAGGAAGCCACTATCTCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGCCT

Ensembl | Número de adesão de ser humano

ENSG00000243135

nº de adesão NCBI

NM_019093

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UGT1A3(54575) , UGT1A3(54659)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
CBV
MAV

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tingting Lin et al.
Journal of experimental & clinical cancer research : CR, 38(1), 150-150 (2019-04-10)
Deregulated ErbB signaling plays an important role in tumorigenesis of pancreatic cancer. However, patients with pancreatic cancer benefit little from current existed therapies targeting the ErbB signaling. Here, we explore the potential anti-tumor activity of Valproic acid against pancreatic cancer
Ming-Chieh Shun et al.
Journal of oncology, 2010, 824571-824571 (2010-03-13)
RRR-alpha-tocopherol derivative alpha-TEA (RRR-alpha-tocopherol ether-linked acetic acid analog) has been shown to be a potent antitumor agent both in vivo and in vitro. In this study, we investigated the effects of alpha-TEA on the expression of epidermal growth factor receptor
Jin Chen et al.
Biochemical and biophysical research communications, 501(1), 212-219 (2018-05-02)
We had previously demonstrated that increased expression of ErbB3 is required for ErbB2-mediated paclitaxel resistance in breast cancer cells. In the present study, we have explored the possible role of mesenchymal stem cells (MSCs) in regulating the paclitaxel-sensitivity of ErbB2/ErbB3-coexpressing
Jinkyoung Kim et al.
BMC cancer, 13, 383-383 (2013-08-14)
Heregulin (HRG; also known as neuregulin) is a ligand for ErbB3. One of its isotypes, HRG-β1, binds to ErbB3 and forms heterodimers with other ErbB family members, thereby enhancing the proliferation and tumorigenesis of breast cancer cells. HRG stimulation may
Xueyan Zhou et al.
Nature communications, 5, 4573-4573 (2014-09-04)
Bile acids play a pivotal role in the pathological development of inflammatory bowel disease (IBD). However, the mechanism of bile acid dysregulation in IBD remains unanswered. Here we show that intestinal peroxisome proliferator-activated receptor α (PPARα)-UDP-glucuronosyltransferases (UGTs) signalling is an
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica