Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU158111

Sigma-Aldrich

MISSION® esiRNA

targeting human TIA1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTA

Ensembl | Número de adesão de ser humano

ENSG00000116001

nº de adesão NCBI

NM_022173

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TIA1(7072) , TIA1(7072)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuzo Abe et al.
Cell & bioscience, 11(1), 122-122 (2021-07-05)
Tumor protein D52 (TPD52) reportedly plays an important role in the proliferation and metastasis of various cancer cells, including oral squamous cell carcinoma (OSCC) cells, and is expressed strongly at the center of the tumor, where the microenvironment is hypoxic.
Xuefeng Yang et al.
Biochimie, 154, 119-126 (2018-08-26)
Gastric cancer (GC) is one of the most common malignancies as well as the third leading cause for cancer-related death. Molecular basis of GC are essential and critical for its therapeutic treatment, but still remain poorly understood. T-cell intracellular antigen-1
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Alice Pasini et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1861(5), 463-472 (2018-03-21)
Cyclooxygenase-2 (COX-2), with its main antifibrotic metabolite PGE2, is regarded as an antifibrotic gene. Repressed COX-2 expression and deficient PGE2 have been shown to contribute to the activation of lung fibroblasts and excessive deposition of collagen in pulmonary fibrosis. We

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica