Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU157031

Sigma-Aldrich

MISSION® esiRNA

targeting human NES

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGAGGCAGAGCTGAATCTGAGGGAGCAGGATGGCTTCACTGGGAAGGAGGAGGTGGTAGAGCAGGGAGAGCTGAATGCCACAGAGGAGGTCTGGATCCCAGGCGAGGGGCACCCAGAGAGCCCTGAGCCCAAAGAGCAGAGAGGCCTGGTTGAGGGAGCCAGTGTGAAGGGAGGGGCTGAGGGCCTCCAGGACCCTGAAGGGCAATCACAACAGGTGGGGGCCCCAGGCCTCCAGGCTCCCCAGGGGCTGCCAGAGGCGATAGAGCCCCTGGTGGAAGATGATGTGGCCCCAGGGGGTGACCAAGCCTCCCCAGAGGTCATGTTGGGGTCAGAGCCTGCCATGGGTGAGTCTGCTGCGGGAGCTGAGCCAGGCCCGGGGCAGGGGGTGGGAGGGCTGGGGGACCCAGGCCATCTGACCAGGGAAGAGGTGATGGAACCACCCCTGGAAGAGGAGAGTTTGGAGGCAAAGAGGGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xu Yang et al.
Kidney & blood pressure research, 43(2), 616-627 (2018-04-25)
Preeclampsia (PE) is a pregnancy-specific hypertensive disorder that is characterised by a high incidence of hypertension and proteinuria. Podocytes are involved in the formation of a split membrane, which is the last barrier preventing the leakage of protein into the
Yasuhiro Shinkai et al.
Nucleic acid therapeutics, 27(3), 168-175 (2017-03-30)
Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Kim Tardif et al.
American journal of physiology. Heart and circulatory physiology, 308(10), H1265-H1274 (2015-03-15)
Proliferation and hypertrophy of vascular smooth muscle cells represent hallmark features of vessel remodeling secondary to hypertension. The intermediate filament protein nestin was recently identified in vascular smooth muscle cells and in other cell types directly participated in proliferation. The

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica