Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU153781

Sigma-Aldrich

MISSION® esiRNA

targeting human SDC1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em23 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em23 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACGGCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACGGGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGCCTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAGAAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAGAAGCCCACCAAACAGGAGGAATTCTATGCCTGACGCGGGAGCCATGCGCCCCCTCCGCCCTGCCACTCACTAGGCCCCCACTTGCCTCTTCCTTGAAGAACTGCAGGCCCTGGCCTCCCCTGCCACCAGGCCACCTCCCCAGCATTCCAGCCCCTCTGGTCGCTCCTGCCCACGGAGTCGTGGGGTGTGCTGGGAGCTCCACTCTGCTTCTCTGACTTCTGCCTGGAGACTTAGGGCACCAGGGGTTTCTCGCATAGGACCTTTCCACCACAGC

Ensembl | Número de adesão de ser humano

ENSG00000115884

nº de adesão NCBI

NM_002997

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SDC1(6382) , SDC1(6382)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
SFT
DHT
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shiyu Hu et al.
Frontiers in microbiology, 11, 105-105 (2020-03-11)
Porcine hemagglutinating encephalomyelitis virus (PHEV) is a single-stranded RNA coronavirus that causes nervous dysfunction in the infected hosts and leads to widespread alterations in the host transcriptome by modulating specific microRNA (miRNA) levels. MiRNAs contribute to RNA virus pathogenesis by
Zhou Jing et al.
Cell biology international, 44(3), 894-904 (2019-12-24)
Disabled-2 (Dab2) and PAR-3 (partitioning defective 3) are reported to play critical roles in maintaining retinal microvascular endothelial cells biology by regulating VEGF-VEGFR-2 signaling. The role of Dab2 and PAR-3 in glomerular endothelial cell (GEnC) is unclear. In this study
Saritha Adepu et al.
American journal of physiology. Renal physiology, 309(2), F137-F145 (2015-05-15)
Syndecan-1 is a transmembrane heparan sulfate proteoglycan involved in regenerative growth and cellular adhesion. We hypothesized that the induction of tubular syndecan-1 is a repair response to incipient renal damage in apparently stable, uncomplicated renal transplant recipients. We quantified tubular
Ildiko Kasza et al.
PLoS genetics, 10(8), e1004514-e1004514 (2014-08-08)
Homeostatic temperature regulation is fundamental to mammalian physiology and is controlled by acute and chronic responses of local, endocrine and nervous regulators. Here, we report that loss of the heparan sulfate proteoglycan, syndecan-1, causes a profoundly depleted intradermal fat layer

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica