Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU153561

Sigma-Aldrich

MISSION® esiRNA

targeting human COL1A1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATT

Ensembl | Número de adesão de ser humano

ENSG00000108821

nº de adesão NCBI

NM_000088

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... COL1A1(1277) , COL1A1(1277)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jing Liu et al.
Discovery medicine, 25(139), 211-223 (2018-06-16)
Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development and metastasis, in which collagen is the major structural protein. Collagen type I alpha 1 (COL1A1) is reportedly associated with the development of
Zheying Zhang et al.
International journal of oncology, 53(5), 1869-1880 (2018-08-23)
Colorectal cancer (CRC) treatment primarily relies on chemotherapy along with surgery, radiotherapy and, more recently, targeted therapy at the late stages. However, chemotherapeutic drugs have high cytotoxicity, and the similarity between the effects of these drugs on cancerous and healthy
Catherine M Willis et al.
PloS one, 9(8), e103966-e103966 (2014-08-05)
Expression of the glycosaminoglycan chondroitin sulfate-E (CS-E) is misregulated in many human cancers, including breast cancer. Cell-surface associated CS-E has been shown to have pro-tumorigenic functions, and pharmacological treatment with exogenous CS-E has been proposed to interfere with tumor progression
Gennaro Di Maro et al.
The Journal of clinical endocrinology and metabolism, 99(9), E1617-E1626 (2014-05-23)
Anaplastic thyroid carcinoma (ATC) is one of the most aggressive human tumors. Twist1 is a basic helix-loop-helix transcription factor involved in cancer development and progression. We showed that Twist1 affects thyroid cancer cell survival and motility. We aimed to identify

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica