Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU151431

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPG2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTG

Ensembl | Número de adesão de ser humano

ENSG00000142798

nº de adesão NCBI

NM_005529

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HSPG2(3339) , HSPG2(3339)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Osama Garwain et al.
Cellular signalling, 71, 109620-109620 (2020-04-05)
Alzheimer's disease is typified by calcium dysfunction and neurofibrillary tangles of tau aggregates along with mitotic proteins. Using PC12 cells as a model system, we determined whether the Gαq/PLCβ/ calcium signaling pathway impacts the manifestation of Alzheimer's disease. Down-regulating PLCβ
Anne M Roesler et al.
Journal of cellular physiology, 234(8), 14187-14197 (2019-01-10)
Airway smooth muscle (ASM) regulation of airway structure and contractility is critical in fetal/neonatal physiology in health and disease. Fetal lungs experience higher Ca2+ environment that may impact extracellular Ca2+ ([Ca2+ ]o ) sensing receptor (CaSR). Well-known in the parathyroid
Cristián Ibarra et al.
Molecular oncology, 13(2), 202-211 (2018-10-26)
Bacillus Calmette-Guérin (BCG) is widely used in the clinic to effectively treat superficial urinary bladder cancer. However, a significant proportion of patients who fail to respond to BCG risk cystectomy or death. Though more than 3 million cancer treatments with
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica