Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU151281

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK6 (2)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACCCATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTCAGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGACGGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTGCCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGAGTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGAGAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCGAGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGCCTTTTATGAGCGAAAAATCGTCACC

Ensembl | Número de adesão de ser humano

ENSG00000140479

nº de adesão NCBI

NM_002570

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PCSK6(5046) , PCSK6(5046)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiao-Feng Tian et al.
Molecular medicine reports, 14(6), 5205-5210 (2016-10-26)
Previous studies have demonstrated the overexpression of paired basic amino acid cleaving enzyme 4 (PACE4) mRNA in prostate cancer tissues. This overexpression is correlated with higher circulating protein levels in certain patients, however, the role of PACE4 in apoptosis and the
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica