Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU150631

Sigma-Aldrich

MISSION® esiRNA

targeting human ADIPOQ, ADIPOQ-AS1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGATCACCACTAACTCAGAGCCTCCTCCAGGCCAAACAGCCCCAAAGTCAAT

Ensembl | Número de adesão de ser humano

ENSG00000181092

nº de adesão NCBI

NM_004797

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADIPOQ(9370) , ADIPOQ(9370)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuu Okura et al.
International journal of molecular sciences, 20(7) (2019-04-03)
Both adiponectin and secreted protein, acidic and rich in cysteine (SPARC) inhibit platelet-derived growth factor-BB (PDGF-BB)-induced and basic fibroblast growth factor (FGF2)-induced angiogenic activities through direct and indirect interactions. Although SPARC enhances nerve growth factor (NGF)-dependent neurogenesis, the physical interaction
Roberta G Marangoni et al.
Scientific reports, 7(1), 4397-4397 (2017-07-02)
Skin fibrosis in systemic sclerosis (SSc) is accompanied by attrition of dermal white adipose tissue (dWAT) and reduced levels of circulating adiponectin. Since adiponectin has potent regulatory effects on fibroblasts, we sought to assess adiponectin signaling in SSc skin biopsies
Juhyun Song et al.
Cell death & disease, 8(10), e3102-e3102 (2017-10-13)
Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by excessive beta amyloid (Aβ) deposition in brain, leading to blood-brain barrier (BBB) disruption. The mechanisms of BBB disruption in AD are still unclear, despite considerable research. The adipokine adiponectin
H-Q Tang et al.
European review for medical and pharmacological sciences, 24(14), 7645-7654 (2020-08-04)
To investigate the expression of Long non-coding RNA ADIPOQ and its facilitating effects on proliferation and invasion of colorectal cancer by modulating the expression of TP53 via sponging with miR-219c-3p. qRT-PCR was performed to detect the expressions of ADIPOQ and

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica