Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU145981

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL11A

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em12 de maio de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em12 de maio de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCTTCAGGACTAGGTGCAGAATGTCCTTCCCAGCCACCTCTCCATGGGATTCATATTGCAGACAATAACCCCTTTAACCTGCTAAGAATACCAGGATCAGTATCGAGAGAGGCTTCCGGCCTGGCAGAAGGGCGCTTTCCACCCACTCCCCCCCTGTTTAGTCCACCACCGAGACATCACTTGGACCCCCACCGCATAGAGCGCCTGGGGGCGGAAGAGATGGCCCTGGCCACCCATCACCCGAGTGCCTTTGACAGGGTGCTGCGGTTGAATCCAATGGCTATGGAGCCTCCCGCCATGGATTTCTCTAGGAGACTTAGAGAGCTGGCAGGGAACACGTCTAGCCCACCGCTGTCCCCAGGCCGGCCCAGCCCTATGCAAAGGTTACTGCAACCATTCCAGCCAGGTAGCAAGCCGCCCTTCCTGGCGACGCCCCCCCTCCCTCCTCTGCAATCCGCCCCTCCTCCCTCCCAGCCCCCGGTCAAGTCCAAGTCATGCGAGTTCTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chen-Han Zhang et al.
Oncotarget, 8(51), 88658-88669 (2017-11-29)
Tamoxifen resistance is a serious problem in the endocrine therapy of breast cancer. Long non-coding RNAs play important roles in tumor development. In this study, we revealed the involvement of lncRNA uc.57 and its downstream gene BCL11A in TAM resistance.
Samarwadee Plianwong et al.
Pharmaceutical research, 37(3), 46-46 (2020-02-06)
Short interfering RNA (siRNA) therapy promises a new era in treatment of breast cancers but effective delivery systems are needed for clinical use. Since silencing complementary targets may offer improved efficacy, this study was undertaken to identify non-viral carriers for
Alberto Daniel-Moreno et al.
Blood cells, molecules & diseases, 84, 102456-102456 (2020-06-05)
β-Hemoglobinopathies are among the most common single-gene disorders and are caused by different mutations in the β-globin gene. Recent curative therapeutic approaches for these disorders utilize lentiviral vectors (LVs) to introduce a functional copy of the β-globin gene into the
Petros Papadopoulos et al.
Human genomics, 14(1), 39-39 (2020-10-18)
The expression of the human β-like globin genes follows a well-orchestrated developmental pattern, undergoing two essential switches, the first one during the first weeks of gestation (ε to γ), and the second one during the perinatal period (γ to β).

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica