Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU143271

Sigma-Aldrich

MISSION® esiRNA

targeting human ILK

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | Número de adesão de ser humano

ENSG00000166333

nº de adesão NCBI

NM_001014794

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ILK(3611) , ILK(3611)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JUU
KNU
ZDS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Qiaomei Zheng et al.
Reproductive sciences (Thousand Oaks, Calif.), 23(11), 1526-1535 (2016-05-01)
To determine whether emodin facilitates the mesenchymal-epithelial transition (MET) of endometrial stromal cells (ESCs) as well as to explore the mechanism through which emodin favored the MET of ESCs. Cell viability was tested by methyl thiazolyl tetrazolium assay. Cell migration
Qiaomei Zheng et al.
Drug design, development and therapy, 14, 3663-3672 (2020-09-29)
To explore the exact mechanism through which emodin down-regulates the migration and invasion abilities of endometrial stromal cells. Moreover, to explore the theoretical basis of emodin in the treatment of endometriosis. Endometriosis endometrial stromal cells (EESs) were cultured from 15
Zhen Xu et al.
European journal of pharmacology, 813, 1-9 (2017-07-04)
To investigate the effect and related mechanism of sirolimus (SRL) in arteriosclerosis(AS) induced by advanced glycation end products (AGEs) in kidney transplantation recipients (KTRs). Human kidney tissues from KTRs before and after treatment with SRL were assessed by hematoxylin-eosin and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica