Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU142761

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGACCACGTATCCCACTTGGAGAATGTGTCAGAGGATGAGATAAACCGACTGCTGGGGATGGTGGTGGATGTGGAGAATCTCTTCATGTCTGTTCACAAGGAAGAGGACACAGACACCAAGCAGGTCTATTTCTACCTCTTCAAGCTACTGCGGAAATGCATCCTGCAGATGACCCGGCCTGTGGTGGAGGGGTCCCTGGGCAGCCCTCCATTTGAGAAACCTAATATTGAGCAGGGTGTGCTGAACTTTGTGCAGTACAAGTTTAGTCACCTGGCTCCCCGGGAGCGGCAGACGATGTTCGAGCTCTCAAAGATGTTCTTGCTCTGCCTTAACTACTGGAAGCTTGAGACACCTGCCCAGTTTCGGCAGAGGTCTCAGGCTGAGGACGTGGCTACCTACAAGGTCAATTACACCAGATGGCTCTGTTACTGCCACGTGCCCCAGAGCTGTGATAGCCTCCCCCGCTACGAAACCACTCATGTCTTTGGGC

Ensembl | Número de adesão de ser humano

ENSG00000108773

nº de adesão NCBI

NM_021078

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KAT2A(2648) , KAT2A(2648)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Liming Zhao et al.
Oncology letters, 16(3), 3955-3963 (2018-08-22)
Histone acetyltransferase GCN5 is a critical component of the TGF-β/Smad signaling pathway in breast cancer cells; however, it remains unknown whether it is involved in the development and progression of breast cancer. The present study investigated the role of GCN5
Lijun Qiao et al.
Journal of cellular and molecular medicine, 22(11), 5333-5345 (2018-08-07)
General control nondepressible 5 (GCN5), the first identified transcription-related lysine acetyltransferase (KAT), is an important catalytic component of a transcriptional regulatory SAGA (Spt-Ada-GCN5-Acetyltransferase) and ATAC (ADA2A-containing) complex. While GCN5 has been implicated in cancer development, its role in cervical cancer
Kun Liu et al.
International journal of molecular sciences, 16(9), 21897-21910 (2015-09-18)
The general control of nucleotide synthesis 5 (GCN5), which is one kind of lysine acetyltransferases, regulates a number of cellular processes, such as cell proliferation, differentiation, cell cycle and DNA damage repair. However, its biological role in human glioma development
Changhan Ouyang et al.
Autophagy, 16(10), 1753-1770 (2019-12-28)
Macroautophagy/autophagy, a fundamental process for degradation of macromolecules and organelles, occurs constitutively at a basal level and is upregulated in response to stress. Whether autophagy regulates protein acetylation and microtubule stability in vascular smooth muscle cells (VSMCs) migration, however, remains

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica