Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU140721

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CR1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGAAGGGA

Ensembl | Número de adesão de ser humano

ENSG00000168329

nº de adesão NCBI

NM_001337

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CX3CR1(1524) , CX3CR1(1524)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jun Tang et al.
Neuropharmacology, 119, 157-169 (2017-02-06)
Microglia play dual roles after germinal matrix hemorrhage, and the neurotrophic phenotype maybe neuroprotective. However, the phenotype transformation and the way by which neuron-microglia dialogue remain unclear. We raise the hypothesis that a cannabinoid receptor2 agonist (JWH133) accelerates the CX3CR1
Yoshimi Enose-Akahata et al.
Retrovirology, 9, 16-16 (2012-02-18)
The activation of mononuclear phagocytes (MPs), including monocytes, macrophages and dendritic cells, contributes to central nervous system inflammation in various neurological diseases. In HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), MPs are reservoirs of HTLV-I, and induce proinflammatory cytokines and excess T
Lisa Rooper et al.
Journal of ovarian research, 6(1), 57-57 (2013-08-21)
The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Specimens of ovarian teratoma and human fetal tissues were
Sheng-Mou Hou et al.
Arthritis research & therapy, 19(1), 282-282 (2017-12-23)
Osteoarthritis (OA) is a degenerative joint disease that affects the cartilage, synovium, and subchondral bone and is the leading cause of disability in older populations. Specific diagnostic biomarkers are lacking; hence, treatment options for OA are limited. Synovial inflammation is
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica