Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU134341

Sigma-Aldrich

MISSION® esiRNA

targeting human RPN2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGCTGATGTGGTCATC

Ensembl | Número de adesão de ser humano

ENSG00000118705

nº de adesão NCBI

NM_001135771

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RPN2(6185) , RPN2(6185)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jinhai Ren et al.
Experimental biology and medicine (Maywood, N.J.), 245(12), 1009-1015 (2020-05-26)
This study explored the role of ribophorin II (RPN2) in myelodysplastic syndromes (MDSs) cell proliferation and growth and revealed that RPN2 knockdown suppressed OCI-AML3 cell growth and proliferation and triggered cell cycle arrest and elicited apoptosis in OCI-AML3 cells. In
Jikui Sun et al.
Cell death & disease, 11(10), 890-890 (2020-10-23)
Accumulating evidence indicates that the dysregulation of the miRNAs/mRNA-mediated carcinogenic signaling pathway network is intimately involved in glioma initiation and progression. In the present study, by performing experiments and bioinformatics analysis, we found that RPN2 was markedly elevated in glioma
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica