Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU133121

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGCACCGAAGCATCTTATTTTATAGTATATCAACCTTTTGTTTTTAAATTGACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCATCTTTTTTTTTAAATTTTTTCTGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCTGAGTATTTTTCTTTTTACCAGTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAATAATTGGTTCTGGCAAGTTTGGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGACATTTTAAAAACCTGTACACAGTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTATAAGAAATGTGCATCAAGCCAGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACATAAAAAAATTAGCCTGGCATGGTG

Ensembl | Número de adesão de ser humano

ENSG00000102317

nº de adesão NCBI

NM_006743

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RBM3(5935) , RBM3(5935)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Delphine Laustriat et al.
Molecular therapy. Nucleic acids, 4, e262-e262 (2015-11-04)
Major physiological changes are governed by alternative splicing of RNA, and its misregulation may lead to specific diseases. With the use of a genome-wide approach, we show here that this splicing step can be modified by medication and demonstrate the
Zhiming Cui et al.
Journal of molecular neuroscience : MN, 54(2), 252-263 (2014-03-29)
Hypoxia and other adverse conditions are usually encountered by rapidly growing cells. The RNA-binding motif protein 3 (RBM3) is induced by low temperature and hypoxia. However, its expression and function in spinal cord injury are still unclear. To investigate the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica