Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU132881

Sigma-Aldrich

MISSION® esiRNA

targeting human APLNR

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACCATCATGCTGACCTGTTACTTCTTCATCGCCCAAACCATCGCTGGCCACTTCCGCAAGGAACGCATCGAGGGCCTGCGGAAGCGGCGCCGGCTGCTCAGCATCATCGTGGTGCTGGTGGTGACCTTTGCCCTGTGCTGGATGCCCTACCACCTGGTGAAGACGCTGTACATGCTGGGCAGCCTGCTGCACTGGCCCTGTGACTTTGACCTCTTCCTCATGAACATCTTCCCCTACTGCACCTGCATCAGCTACGTCAACAGCTGCCTCAACCCCTTCCTCTATGCCTTTTTCGACCCCCGCTTCCGCCAGGCCTGCACCTCCATGCTCTGCTGTGGCCAGAGCAGGTGCGCAGGCACCTCCCACAGCAGCAGTGGGGAGAAGTCAGCCAGCTACTCTTCGGGGCACAGCCAGGGGCCCGGCCCCAACATGGGCAAGGGTGGAGAACAGATGCACGAGAAATCCATCCCCTA

Ensembl | Número de adesão de ser humano

ENSG00000134817

nº de adesão NCBI

NM_005161

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... APLNR(187) , APLNR(187)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
KYU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lu Zhou et al.
American journal of physiology. Endocrinology and metabolism, 316(5), E773-E781 (2019-03-13)
Preeclampsia (PE) is a major cause of maternal mortality and morbidity worldwide. Although there has been great progress in the understanding of PE, the exact cause for the disease development is still unclear. Recently, studies showed that genetic deletion of
Lei Cui et al.
Anti-cancer drugs, 30(9), 940-947 (2019-03-29)
Osteosarcoma is the most common type of bone malignancies with a poor prognosis. In recent years, targeted therapy has shown great potential in the treatment of osteosarcoma, and more effective therapeutic targets for this disease need to be developed. APLNR
Bingyuan Ji et al.
Cellular signalling, 73, 109671-109671 (2020-05-15)
Apelin receptor (APJ) and bradykinin B2 receptor (B2R) play an important role in many physiological processes and share multiple similar characteristics in distribution and functions in the cardiovascular system. We first identified the endogenous expression of APJ and B2R in
Weilin Xu et al.
Journal of neuroinflammation, 16(1), 247-247 (2019-12-04)
Neuroinflammation and oxidative stress play important roles in early brain injury following subarachnoid hemorrhage (SAH). This study is the first to show that activation of apelin receptor (APJ) by apelin-13 could reduce endoplasmic reticulum (ER)-stress-associated inflammation and oxidative stress after
Andrew G Masoud et al.
The Journal of clinical investigation, 130(1), 94-107 (2019-11-19)
Sustained, indolent immune injury of the vasculature of a heart transplant limits long-term graft and recipient survival. This injury is mitigated by a poorly characterized, maladaptive repair response. Vascular endothelial cells respond to proangiogenic cues in the embryo by differentiation
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica