Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU131981

Sigma-Aldrich

MISSION® esiRNA

targeting human HBP1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CATTGGAGTTGCTGCAGTGTAATGAGAATTTGCCATCTTCACCTGGATATAACTCCTGTGATGAACACATGGAGCTTGATGACCTTCCTGAACTTCAGGCAGTTCAAAGTGATCCTACCCAATCTGGCATGTACCAGCTGAGTTCAGATGTTTCACATCAAGAATACCCAAGATCATCTTGGAACCAAAATACCTCAGACATACCAGAAACTACTTACCGTGAAAATGAGGTGGACTGGCTAACAGAATTGGCAAATATCGCGACCAGTCCACAAAGTCCACTGATGCAGTGCTCATTTTACAATAGATCATCTCCTGTACACATCATAGCCACTAGCAAAAGTTTACATTCCTATGCACGCCCTCCACCAGTGTCCTCTTCTTCGAAGAGTGAACCAGCCTTC

Ensembl | Número de adesão de ser humano

ENSG00000105856

nº de adesão NCBI

NM_012257

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HBP1(26959) , HBP1(26959)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiyong Yan et al.
FEBS letters, 588(17), 3038-3046 (2014-06-17)
We found that miR-96 is overexpressed in glioma, and its level inversely correlates with the survival of patients. The reduction in miR-96 abundance suppresses the proliferation and colony formation of glioma cells. The tumorigenicity of U-87 MG cells is reduced
Z Z Yao et al.
Journal of biological regulators and homeostatic agents, 34(2), 357-366 (2020-06-19)
This study aims to explore the effect of p38 mitogen-activated protein kinase and its downstream target HMG-box transcription factor 1 (HBP1) in the chondrocyte (CH) senescence caused by hyperosmotic stress. Human cartilage tissue with or without osteoarthritis (OA) were collected
Ruo-Chia Tseng et al.
Journal of cellular and molecular medicine, 18(9), 1752-1761 (2014-06-05)
β-catenin nuclear accumulation is frequently identified in human non-small cell lung cancer (NSCLC). The HMG-box transcription factor 1 (HBP1) is a known repressor of β-catenin transactivation. However, the role of HBP1 in relation to β-catenin nuclear accumulation has not been

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica