Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU131781

Sigma-Aldrich

MISSION® esiRNA

targeting human MUL1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGAAGCTCCAGGAAAATGCGTGCCTTATGCTGTTATAGAAGGAGCTGTGCGGTCTGTTAAAGAAACGCTTAACAGCCAGTTTGTGGAAAACTGCAAGGGGGTAATTCAGCGGCTGACACTTCAGGAGCACAAGATGGTGTGGAATCGAACCACCCACCTTTGGAATGATTGCTCAAAGATCATTCATCAGAGGACCAACACAGTGCCCTTTGACCTGGTGCCCCACGAGGATGGCGTGGATGTGGCTGTGCGAGTGCTGAAGCCCCTGGACTCAGTGGATCTGGGTCTAGAGACTGTGTATGAGAAGTTCCACCCCTCGATTCAGTCCTTCACCGATGTCATCGGCCACTACATCAGCGGTGAGCGGCCCAAAGGCATCCAAGAGACCGAGGAGATGCTGAAGGTGGGGGCCACCCTCACAGGGGTTGGCGAACTGGTCCTGGACAACAACTCTGTCCGCCT

Ensembl | Número de adesão de ser humano

ENSG00000090432

nº de adesão NCBI

NM_024544

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MUL1(79594) , MUL1(79594)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yanfang Zhao et al.
Biochimica et biophysica acta, 1863(11), 2871-2881 (2017-08-08)
The pathogenesis of cardiac hypertrophy is tightly associated with mitochondrial dysfunction. Disequilibrium of mitochondrial dynamic is one of the main drivers in the pathological processes during development of various cardiac diseases. However, the effect of mitochondrial dynamics on cardiac hypertrophy
Sun-Yong Kim et al.
Oncotarget, 6(32), 33382-33396 (2015-10-10)
Recent research on non-thermal plasma (NTP, an ionized gas) has identified it as a novel cancer therapeutic tool. However, the molecular mechanism remains unclear. In this study, we demonstrated NTP induced cell death of head and neck cancer (HNC) through
Jina Yun et al.
eLife, 3, e01958-e01958 (2014-06-06)
Parkinson's disease (PD) genes PINK1 and parkin act in a common pathway that regulates mitochondrial integrity and quality. Identifying new suppressors of the pathway is important for finding new therapeutic strategies. In this study, we show that MUL1 suppresses PINK1
Rajat Puri et al.
Nature communications, 10(1), 3645-3645 (2019-08-15)
Chronic mitochondrial stress associates with major neurodegenerative diseases. Recovering stressed mitochondria constitutes a critical step of mitochondrial quality control and thus energy maintenance in early stages of neurodegeneration. Here, we reveal Mul1-Mfn2 pathway that maintains neuronal mitochondrial integrity under stress

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica