Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU131291

Sigma-Aldrich

MISSION® esiRNA

targeting human MTA1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGA

Ensembl | Número de adesão de ser humano

ENSG00000182979

nº de adesão NCBI

NM_004689

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MTA1(9112) , MTA1(9112)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HQS
CJS
XHS
FQR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

S Deivendran et al.
Scientific reports, 7, 44225-44225 (2017-04-11)
Despite a recognized role of DNA methyltransferase 3a (DNMT3a) in human cancer, the nature of its upstream regulator(s) and relationship with the master chromatin remodeling factor MTA1, continues to be poorly understood. Here, we found an inverse relationship between the
Yongqin Pan et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1398-1406 (2016-10-25)
Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological
Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica