Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU131141

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGCCTCTGATTGGCACAGTGCTGGCCATGGACCCTGATGCGGCTAGGCATAGCATTGGATACTCCATCCGCAGGACCAGTGACAAGGGCCAGTTCTTCCGAGTCACAAAAAAGGGGGACATTTACAATGAGAAAGAACTGGACAGAGAAGTCTACCCCTGGTATAACCTGACTGTGGAGGCCAAAGAACTGGATTCCACTGGAACCCCCACAGGAAAAGAATCCATTGTGCAAGTCCACATTGAAGTTTTGGATGAGAATGACAATGCCCCGGAGTTTGCCAAGCCCTACCAGCCCAAAGTGTGTGAGAACGCTGTCCATGGCCAGCTGGTCCTGCAGATCTCCGCAATAGACAAGGACATAACACCACGAAACGTGAAGTTCAAATTCATCTTGAATACTGAGAACAACTTTACCCTCACGGATAATCACGATAACACGGCCAACATCACAGTCAAGTATGGGCAGTTTGACCG

Ensembl | Número de adesão de ser humano

ENSG00000179776

nº de adesão NCBI

NM_001795

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDH5(1003) , CDH5(1003)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
WQS
DHT
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiyong Wu et al.
American journal of translational research, 8(10), 4310-4319 (2016-11-11)
Angiotensin II (AngII) involved in the pathogenesis of pulmonary injury through impairing the integrity of pulmonary microvascular endothelial barrier, but the mechanism is still not clear. We aim to determine the roles of VE-cadherin, playing crucial roles in the adhesion
Miwa Sato et al.
PloS one, 10(9), e0137301-e0137301 (2015-09-04)
We developed a microfluidic model of microcirculation containing both blood and lymphatic vessels for examining vascular permeability. The designed microfluidic device harbors upper and lower channels that are partly aligned and are separated by a porous membrane, and on this
Natalia Colás-Algora et al.
Cellular and molecular life sciences : CMLS, 77(11), 2125-2140 (2019-08-10)
VE-cadherin plays a central role in controlling endothelial barrier function, which is transiently disrupted by proinflammatory cytokines such as tumor necrosis factor (TNFα). Here we show that human endothelial cells compensate VE-cadherin degradation in response to TNFα by inducing VE-cadherin

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica