Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130941

Sigma-Aldrich

MISSION® esiRNA

targeting human FGL2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCCAAAGAGGAGATCAATGTACTTCATGGTCGCCTGGAGAAGCTGAATCTTGTAAATATGAACAACATAGAAAATTATGTTGACAGCAAAGTGGCAAATCTAACATTTGTTGTCAATAGTTTGGATGGCAAATGTTCAAAGTGTCCCAGCCAAGAACAAATACAGTCACGTCCAGTTCAACATCTAATATATAAAGATTGCTCTGACTACTACGCAATAGGCAAAAGAAGCAGTGAGACCTACAGAGTTACACCTGATCCCAAAAATAGTAGCTTTGAAGTTTACTGTGACATGGAGACCATGGGGGGAGGCTGGACAGTGCTGCAGGCACGTCTCGATGGGAGCACCAACTTCACCAGAACATGGCAAGACTACAAAGCAGGCTTTGGAAACCTCAGAAGGGAATTTTGGCTG

Ensembl | Número de adesão de ser humano

ENSG00000127951

nº de adesão NCBI

NM_006682

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FGL2(10875) , FGL2(10875)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ming Tang et al.
Scientific reports, 7(1), 12676-12676 (2017-10-06)
Fibrinogen-like protein 2 (FGL2) is highly expressed in various tumour tissues and plays a vital role in tumour initiation and progression. This study evaluated the clinical significance of FGL2 in patients with clear cell renal cell carcinoma (ccRCC). FGL2 expression
Yueying Wang et al.
Molecular reproduction and development, 86(4), 354-369 (2019-01-12)
Embryonic implantation involves a complex and well-coordinated interaction between the developing conceptus and maternal uterus, and the preimplantation period has a major impact on litter size in pigs. The present study aimed to investigate the vital messenger RNAs (mRNAs) and

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica