Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130651

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFAF1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTGTGAGCCGTCAGTGAAACACTTAGAGCAGTTTCTGGCACATGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGC

Ensembl | Número de adesão de ser humano

ENSG00000137806

nº de adesão NCBI

NM_016013

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NDUFAF1(51103) , NDUFAF1(51103)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kelly Quesnelle et al.
Nitric oxide : biology and chemistry, 104-105, 36-43 (2020-09-07)
It is well established that myoglobin supports mitochondrial respiration through the storage and transport of oxygen as well as through the scavenging of nitric oxide. However, during ischemia/reperfusion (I/R), myoglobin and mitochondria both propagate myocardial injury through the production of
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica