Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU127561

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGGACGATAAGACCGTGTATGAGTACCTGTTCAGCCAGCGGCGAAAACGGCGGGCCCCACTGGCCACTCGCCAGGGCAAGCGACCCAGCAAGAACCTTAAGGCTCGCTGCAGTCGGAAGGCACTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCACCCCTTGAGTACGAGGCTTTCCACTGCGAGGGGCTGTGCGAGTTCCCATTGCGCTCCCACCTGGAGCCCACGAATCATGCAGTCATCCAGACCCTGATGAACTCCATGGACCCCGAGTCCACACCACCCACCTGCTGTGTGCCCACGCGGCTGAGTCCCATCAGCATCCTCTTCATTGACTCTGCCAACAACGTGGTGTATAAGCAGTATGAGGACATGGTCGTGGAGTCGTGTGGCTGCAGGTAGCAGCACTGGCCCTCTGTCTTCCTGGGTGGCACATCCCAAGAGCCCCTTCCTGCACTCCTGGAATCACAGAGGGGTCAGGAAGCTGTGGCAGGAGCATCTACA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Md Fahmid Islam et al.
Scientific reports, 7(1), 1040-1040 (2017-04-23)
Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This
Wei Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1414-1421 (2016-10-25)
The precise role of interleukin-1 beta (IL-1β)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation
Dagmara M Wiatrek et al.
RNA (New York, N.Y.), 25(6), 713-726 (2019-03-22)
Viral and cellular double-stranded RNA (dsRNA) is recognized by cytosolic innate immune sensors, including RIG-I-like receptors. Some cytoplasmic dsRNA is commonly present in cells, and one source is mitochondrial dsRNA, which results from bidirectional transcription of mitochondrial DNA (mtDNA). Here

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica