Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU124131

Sigma-Aldrich

MISSION® esiRNA

targeting human PKN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTCACCTCTGACCCTCGAAGATTTCAAGTTCCTGGCGGTGCTGGGCCGGGGTCATTTTGGGAAGGTGCTCCTCTCCGAATTCCGGCCCAGTGGGGAGCTGTTCGCCATCAAGGCTCTGAAGAAAGGGGACATTGTGGCCCGAGACGAGGTGGAGAGCCTGATGTGTGAGAAGCGGATATTGGCGGCAGTGACCAGTGCGGGACACCCCTTCCTGGTGAACCTCTTCGGCTGTTTCCAGACACCGGAGCACGTGTGCTTCGTGATGGAGTACTCGGCCGGTGGGGACCTGATGCTGCACATCCACAGCGACGTGTTCTCTGAGCCCCGTGCCATCTTTTATTCCGCCTGCGTGGTGCTGGGCCTACAGTTTCTTCACGAACACAAGATCGTCTACAGGGACCTGAAGTTGGACAATTTGCTCCTGGACACC

Ensembl | Número de adesão de ser humano

ENSG00000123143

nº de adesão NCBI

NM_002741

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PKN1(5585) , PKN1(5585)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica