Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU123931

Sigma-Aldrich

MISSION® esiRNA

targeting human NUDT1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em29 de abril de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em29 de abril de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAAGAAGGAGAGACCATCGAGGATGGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATCGTGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGACCCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGGCCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAGGGTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGGGCAGGAGACGTGGCTGCTGAACAG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhen Chen et al.
Cancer cell international, 20, 337-337 (2020-07-28)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor. More than half of GBMs contain mutation(s) of PTEN/PI3K/AKT, making inhibitors targeting the PI3K pathway very attractive for clinical investigation. However, so far, PI3K/AKT/mTOR inhibitors have
Ya Gao et al.
Oncotarget, 8(56), 95865-95879 (2017-12-10)
Cancer cells are more addictive to MTH1 than normal cells because of their dysfunctional redox regulations. MTH1 plays an important role to maintain tumor cell survival, while it is not indispensable for the growth of normal cells. Farnesyl phenols having
Bharathan Bhavya et al.
Life sciences, 264, 118673-118673 (2020-11-02)
The study focused on the expression and role of a recent potential cancer therapeutic target protein, MutT Homolog1 (MTH1). MTH1 gets activated in an increased reactive oxygen species (ROS) environment and removes the oxidized nucleotides from the cell. The study

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica