Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU122971

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF7

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGGGGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGACCCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCCCCATCTTCGACTTCAGAGTCTTCTTCCAAGAGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGGGCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGCTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCCCTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGAGC

Ensembl | Número de adesão de ser humano

ENSG00000185507

nº de adesão NCBI

NM_001572

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IRF7(3665) , IRF7(3665)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rie Miyamoto et al.
Arthritis research & therapy, 12(3), R87-R87 (2010-05-18)
Plasmacytoid dendritic cells (pDCs) play not only a central role in the antiviral immune response in innate host defense, but also a pathogenic role in the development of the autoimmune process by their ability to produce robust amounts of type
Wenxin Wu et al.
Viruses, 12(4) (2020-04-03)
Influenza A virus (IAV) infection is a major cause of morbidity and mortality. Retinoic acid-inducible protein I (RIG-I) plays an important role in the recognition of IAV in most cell types, and leads to the activation of interferon (IFN). We
Kosuke Minaga et al.
Journal of gastroenterology, 55(5), 565-576 (2020-01-22)
Excessive type I IFN (IFN-I) production by plasmacytoid dendritic cells (pDCs) promotes autoimmunity. Recently, we reported that a prominent feature of both experimental autoimmune pancreatitis (AIP) and human type 1 AIP is pDC activation followed by enhanced production of IFN-I
N Ueno et al.
Oncogene, 36(31), 4481-4497 (2017-04-04)
We previously reported that PU.1 is downregulated in the majority of myeloma cell lines and primary myeloma cells of certain myeloma patients, and conditional expression of PU.1 in such myeloma cell lines induced cell cycle arrest and apoptosis. We found
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica