Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | Número de adesão de ser humano

ENSG00000175084

nº de adesão NCBI

NM_001927

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DES(1674) , DES(1674)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ji Hyun Kim et al.
Anatomy & cell biology, 46(4), 272-284 (2014-01-05)
Carbonic anhydrase type IX (CA9) is known to express in the fetal joint cartilage to maintain pH against hypoxia. Using paraffin-embedded histology of 10 human fetuses at 10-16 weeks of gestation with an aid of immunohistochemistry of the intermediate filaments
Monica Gunetti et al.
PloS one, 7(9), e45538-e45538 (2012-10-03)
Urinary incontinence, defined as the complaint of any involuntary loss of urine, is a pathological condition, which affects 30% females and 15% males over 60, often following a progressive decrease of rhabdosphincter cells due to increasing age or secondary to
Nobuyuki Hinata et al.
BioMed research international, 2014, 906921-906921 (2014-05-31)
Detailed knowledge of the anatomy of the rhabdosphincter and adjacent tissues is mandatory during urologic surgery to ensure reliable oncologic and functional outcomes. To characterize the levator ani (LA) function for the urethral sphincter, we described connective tissue morphology between
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl
Christoph Daniel et al.
PloS one, 8(12), e83846-e83846 (2014-01-01)
We recently identified Thrombospondin-2 (TSP-2) as a regulator of matrix remodelling and inflammation in experimental kidney disease by using TSP-2 null mice and successfully proved TSP-2 overexpression as a therapeutic concept in a short term glomerulonephritis model in the rat.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica