Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU119431

Sigma-Aldrich

MISSION® esiRNA

targeting human PDPN

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAGCCAGCACAGGCCAGCCAGAAGATGACACTGAGACTACAGGTTTGGAAGGCGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCAAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jiang-Chao Li et al.
Molecular medicine reports, 10(3), 1513-1518 (2014-06-19)
Podoplanin (PDPN) is a well established lymphatic endothelial marker and has frequently been observed in cancer cells at the edge of cancer masses. Previous studies investigating the association between PDPN expression and patient prognosis have had contradictory results. In the
Ekele Ikpegbu et al.
Journal of cellular physiology, 233(7), 5334-5347 (2017-12-08)
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the
Lewis S C Ward et al.
Journal of cell science, 132(5) (2019-02-13)
Mesenchymal stromal cells (MSCs) upregulate podoplanin at sites of infection, chronic inflammation and cancer. Here, we investigated the functional consequences of podoplanin expression on the migratory potential of MSCs and their interactions with circulating platelets. Expression of podoplanin significantly enhanced
Lusine Danielyan et al.
EBioMedicine, 60, 102989-102989 (2020-09-14)
Stem cells` (SC) functional heterogeneity and its poorly understood aetiology impedes clinical development of cell-based therapies in regenerative medicine and oncology. Recent studies suggest a strong correlation between the SC migration potential and their therapeutic efficacy in humans. Designating SC
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica