Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU119261

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGAGGTCAGTAGTTTAAAAGTTCTTAGTTATATAGCATCTGGAAGATCATTTTGAAATTGTTCCTTGGAGAAATGAAAACAGTGTGTAAACAAAATGAAGCTGCCCTAATAAAAAGGAGTATACAAACATTTAAGCTGTGGTCAAGGCTACAGATGTGCTGACAAGGCACTTCATGTAAAGTGTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCT

Ensembl | Número de adesão de ser humano

ENSG00000125384

nº de adesão NCBI

NM_000956

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTGER2(5732) , PTGER2(5732)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fusako Sakai-Takemura et al.
Communications biology, 3(1), 182-182 (2020-04-22)
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release
Qian Zhang et al.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, 34(4), 606-617 (2018-07-10)
Secondary hyperparathyroidism (SHPT) in patients with end-stage renal disease (ESRD) is characterized by hyperplasia of the parathyroid glands (PTGs), while the underlying mechanism is not completely understood. Previously we demonstrated a relationship between cyclooxygenase 2 (COX2) overexpression and parathyroid hyperplasia
Jigisha A Patel et al.
International journal of molecular sciences, 19(8) (2018-08-15)
Prostacyclins are extensively used to treat pulmonary arterial hypertension (PAH), a life-threatening disease involving the progressive thickening of small pulmonary arteries. Although these agents are considered to act therapeutically via the prostanoid IP receptor, treprostinil is the only prostacyclin mimetic

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica