Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU116671

Sigma-Aldrich

MISSION® esiRNA

targeting human CHKB, CHKB-CPT1B

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAAGCAAGGCCCACAGACTACCCCACTCAAGAACAGCAGTTGCATTTTATTCGTCATTACCTGGCAGAGGCAAAGAAAGGTGAGACCCTCTCCCAAGAGGAGCAGAGAAAACTGGAAGAAGATTTGCTGGTAGAAGTCAGTCGGTATGCTCTGGCATCCCATTTCTTCTGGGGTCTGTGGTCCATCCTCCAGGCATCCATGTCCACCATAGAATTTGGTTACTTGGACTATGCCCAGTCTCGGTTCCAGTTCTACTTCCAGCAGAAGGGGCAGCTGACCAGTGTCCACTCCTCATCCTGACTCC

Ensembl | Número de adesão de ser humano

ENSG00000100288

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CHKB(1120) , CHKB(1120)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JUU
NRR
RPR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

F Ye et al.
Cancer gene therapy, 21(5), 209-217 (2014-05-24)
Mammalian checkpoint kinases 1 and 2 (Chk1 and Chk2) are essential kinases that are involved in cell cycle checkpoint control, and the abrogation of either has been proposed as one way to sensitize cancer cells to DNA-damaging agents. However, it
Xiaoyun Yang et al.
Life sciences, 106(1-2), 12-18 (2014-04-22)
The checkpoint kinase 1 (Chk1) functions not only in genotoxic stresses but also in normal cell cycle progression, particularly in the initiation, progression and fidelity of unperturbed mitosis. In this study, we investigated the role of Chk1 in regulating the
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica