Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU115561

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6A (1)

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTGTCGTATCAGCAGGAAATCTTCTAAGCCATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGGAGCAGAACACCAGGTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGCCCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTCTGTGAAAAAAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTTTATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATAAATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAATGTTGGTCCACT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hongya Han et al.
PloS one, 9(1), e85085-e85085 (2014-01-28)
Arachidonate 15-lipoxygenase-1 (ALOX15) oxygenates polyunsaturated fatty acids and bio-membranes, generating multiple lipid signalling mediators involved in inflammation. Several lines of evidence indicate that ALOX15 activation in the respiratory tract contributes to asthma progression. Recent experimental data reveals that histone modification
Rakel Brendsdal Forthun et al.
PloS one, 7(11), e48992-e48992 (2012-11-17)
The mechanisms of successful epigenetic reprogramming in cancer are not well characterized as they involve coordinated removal of repressive marks and deposition of activating marks by a large number of histone and DNA modification enzymes. Here, we have used a
Shayesta Seenundun et al.
The EMBO journal, 29(8), 1401-1411 (2010-03-20)
Polycomb (PcG) and Trithorax (TrxG) group proteins act antagonistically to establish tissue-specific patterns of gene expression. The PcG protein Ezh2 facilitates repression by catalysing histone H3-Lys27 trimethylation (H3K27me3). For expression, H3K27me3 marks are removed and replaced by TrxG protein catalysed
Hiroyuki Imuta et al.
Heart and vessels, 35(12), 1746-1754 (2020-07-18)
Macrophages play a crucial role in the development of atherosclerosis. To explore the mechanism by which macrophages attain a proinflammatory phenotype for a sustained period, we stimulated macrophages with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) and measured the interleukin-1β (IL-1β) expression.
Rintaro Hashizume et al.
Nature medicine, 20(12), 1394-1396 (2014-11-18)
Pediatric brainstem gliomas often harbor oncogenic K27M mutation of histone H3.3. Here we show that GSKJ4 pharmacologic inhibition of K27 demethylase JMJD3 increases cellular H3K27 methylation in K27M tumor cells and demonstrate potent antitumor activity both in vitro against K27M

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica