Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU115141

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA8

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTG

Ensembl | Número de adesão de ser humano

ENSG00000109971

nº de adesão NCBI

NM_006597

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HSPA8(3312) , HSPA8(3312)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
EDV
BBV
XDU
YRS
WGT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Midori Ikezaki et al.
Biochemical and biophysical research communications, 527(2), 481-488 (2020-04-28)
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone, is involved in multiple cellular functions. We previously demonstrated that Hsc70 is required for TGF-β-induced Smad signaling in mesenchymal-like NRK-49F cells. In the present study, to compare the Hsc70 functions in TGF-β-related
Ximeng Yang et al.
Scientific reports, 8(1), 11707-11707 (2018-08-05)
We previously found diosgenin, an herbal drug-derived steroid sapogenin, to be remarkably effective at restoring Aβ-induced axonal degeneration and improving memory function in model of Alzheimer's disease (AD), 5XFAD mouse. In this study, we investigated the downstream signaling of diosgenin
Guan Sun et al.
Journal of cellular biochemistry, 120(6), 10707-10714 (2019-03-01)
Migration and invasion are often recognized as the main reasons for the high recurrence and death rates of glioma and limit the efficacy of surgery and other antitumor therapies. In this study, we found over activation of heat shock cognate
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Nerea Allende-Vega et al.
Scientific reports, 9(1), 5637-5637 (2019-04-06)
Eliminating mutant p53 (mt p53) protein could be a useful strategy to treat mt p53 tumors and potentially improve the prognosis of cancer patients. In this study, we unveil different mechanisms that eliminate p53-R248Q, one of the most frequent mutants
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica