Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU114701

Sigma-Aldrich

MISSION® esiRNA

targeting human CD46

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTCTCAGATGACGCCTGTTATAGAGAAACATGTCCATATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGGACTTACGAGTTTGGTTATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATTCTATATTGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTTTTGTGTACACCACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTATTTGAGTATCTTGATGCAGTAACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTTTCACTTATTGGAGAGAGCACGATTTATTGTGGTGACAATTCAGTGTGGAGTCGTGCTGCTCCAGAGTGTA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kathryn R Stein et al.
Nature communications, 10(1), 2699-2699 (2019-06-22)
Human cytomegalovirus (CMV) causes a wide array of disease to diverse populations of immune-compromised individuals. Thus, a more comprehensive understanding of how CMV enters numerous host cell types is necessary to further delineate the complex nature of CMV pathogenesis and
Pei Qiao et al.
Scientific reports, 7(1), 145-145 (2017-03-10)
Bullous pemphigoid (BP) is an autoimmune bullous disease caused by autoantibodies against BP180 in the epidermal basement membrane. Autoantibody-mediated complement activation is an important process in BP pathogenesis. CD46, a crucial complement regulatory protein in the complement activation, has been
Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica