Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU111231

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTA2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ling Li et al.
BMC microbiology, 8, 26-26 (2008-02-08)
Porphyromonas gingivalis is associated with periodontal disease and invades different cell types including epithelial, endothelial and smooth muscle cells. In addition to P. gingivalis DNA, we have previously identified live invasive bacteria in atheromatous tissue. However, the mechanism of persistence
Melissa A Kinney et al.
Scientific reports, 4, 4290-4290 (2014-03-07)
Stem cell fate and function are dynamically modulated by the interdependent relationships between biochemical and biophysical signals constituting the local 3D microenvironment. While approaches to recapitulate the stem cell niche have been explored for directing stem cell differentiation, a quantitative
Sachiko Asakawa et al.
Anatomy & cell biology, 48(1), 36-43 (2015-03-26)
We examined morphological differences between the sublingual and submandibular glands with special reference to their innervation. The sublingual gland contained abundant periodic acid Schiff-positive mucous acini: some lobules were composed of purely mucous acini, while others were purely serous or
Charlotte Thålin et al.
Thrombosis research, 139, 56-64 (2016-02-27)
Large elevations of high sensitive Troponin T (hsTnT) in ischemic stroke patients is associated with a poor outcome. In a pilot study we found a high prevalence of malignancies among these patients. Since neutrophil extracellular traps (NETs) have been linked
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica