Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU108131

Sigma-Aldrich

MISSION® esiRNA

targeting human RPL11

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATCTGTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACCCCTGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTCCACTGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAGTTAAGAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGTATCAAATATGACCCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGCATC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

DongDong Tong et al.
Oncogenesis, 9(5), 56-56 (2020-06-03)
Methyl-CpG-binding protein 2 (MeCP2) facilitates the carcinogenesis and progression of several types of cancer. However, its role in breast cancer and the relevant molecular mechanism remain largely unclear. In this study, analysis of the Cancer Genome Atlas (TCGA) data that
Ting Tao et al.
Cell research, 23(5), 620-634 (2013-01-30)
p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however, little is known about p53 turnover through proteasome-independent pathway(s). The digestive organ expansion factor (Def) protein is essential for the development

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica