Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU106681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6AP2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCAGTTCACTCCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGACCTGCTCTTTCTTTCTGAACTGCAAGTGCTACATGATATTTCAAGCTTGCTGTCTCGTCATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAGCGTTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTACAGTCTTTATGGTGGGAATGCAGTGGTAGAGTTAGTCACTGTCAAGTCATTTGACACCTCCCTCATTAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGCGAAGAACCCAGCAAGTCCCTATAACCTTGCATATAAGTATAATTTTGAATATTCCGTGGTTTTCAACATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGAT

Ensembl | Número de adesão de ser humano

ENSG00000182220

nº de adesão NCBI

NM_005765

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ATP6AP2(10159) , ATP6AP2(10159)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PBV

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ting-Ting Chang et al.
European journal of clinical investigation, 46(6), 544-554 (2016-04-12)
Endothelial progenitor cell (EPC) functions are impaired in the presence of diabetes mellitus. Aliskiren is a direct renin inhibitor, which is expected to modify proangiogenic cells. This study aimed to investigate whether and how aliskiren could improve the function of
Kaori Narumi et al.
Scientific reports, 8(1), 16-16 (2018-01-10)
(Pro)renin receptor [(P)RR] is expressed in the kidney and is involved in renal injury. Although (P)RR is activated by indoxyl sulfate (IS) and may be related to renal injury, the details remain unclear. We used mouse mesangial cell line SV40
Asadur Rahman et al.
Molecular cancer therapeutics, 19(9), 1844-1855 (2020-07-17)
We previously reported that silencing of the PRR gene, which encodes the (pro)renin receptor [(P)RR], significantly reduced Wnt/β-catenin-dependent development of pancreatic ductal adenocarcinoma (PDAC). Here, we examined the effects of a panel of blocking mAbs directed against the (P)RR extracellular
Heike Wanka et al.
Journal of cellular and molecular medicine, 21(7), 1394-1410 (2017-02-20)
The (pro)renin receptor [(P)RR, ATP6AP2] is a multifunctional transmembrane protein that activates local renin-angiotensin systems, but also interacts with Wnt pathways and vacuolar H
Nehman Makdissy et al.
Stem cell research & therapy, 9(1), 132-132 (2018-05-13)
The subcellular distribution of prorenin receptor and adaptor protein ATP6AP2 may affect neurogenesis. In this study, we hypothesized that ATP6AP2 expression and subcellular relocalization from caveolae/lipid raft microdomains (CLR-Ms) to intracellular sites may correlate with neuronal differentiation (Neu-Dif) of adipose-derived
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica