Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU105871

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hongjuan Li et al.
American journal of cancer research, 8(5), 835-851 (2018-06-12)
Ovarian carcinoma is a fatal malignancy in gynecological malignancies, and the prognosis still remains poor due to the lack of effective therapeutic targets. This study demonstrated that centromere protein U (CENPU) was up-regulated in ovarian cancer. The ectopic expression of
Deokcheol Lee et al.
Scientific reports, 8(1), 9601-9601 (2018-06-27)
Although various surgical procedures have been developed for chronic rotator cuff tear repair, the re-tear rate remains high with severe fat infiltration. However, little is known about the molecular regulation of this process. Mesenchymal stem cells (MSCs) in the intra-muscular
María Cámara-Quílez et al.
Cancers, 12(9) (2020-09-02)
High mobility group box B (HMGB) proteins are overexpressed in different types of cancers such as epithelial ovarian cancers (EOC). We have determined the first interactome of HMGB1 and HMGB2 in epithelial ovarian cancer (the EOC-HMGB interactome). Libraries from the
Cuiping Zhang et al.
Haematologica, 105(3), 573-584 (2019-06-07)
Hematopoietic stem cells provide life-long production of blood cells and undergo self-renewal division in order to sustain the stem cell pool. Homeostatic maintenance of hematopoietic stem cell pool and blood cell production is vital for the organism to survive. We

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica