Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU104701

Sigma-Aldrich

MISSION® esiRNA

targeting human CLIC4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCAGAGGCTCTTCATGATTCTTTGGCTCAAAGGAGTTGTATTTAGTGTGACGACTGTTGACCTGAAAAGGAAGCCAGCAGACCTGCAGAACTTGGCTCCCGGGACCCACCCACCATTTATAACTTTCAACAGTGAAGTCAAAACGGATGTAAATAAGATTGAGGAATTTCTTGAAGAAGTCTTATGCCCTCCCAAGTACTTAAAGCTTTCACCAAAACACCCAGAATCAAATACTGCTGGAATGGACATCTTTGCCAAATTCTCTGCATATATCAAGAATTCAAGGCCAGAGGCTAATGAAGCACTGGAGAGGGGTCTCCTGAAAACCCTGCAGAAACTGGATGAATATCTGAATTCTCCTCTCCCTGATGAAATTGATGAAAATAGTATGGAGGACATAAAGTTTTCTACACGTAAATTTCTGGATGGCAATGAAATGA

Ensembl | Número de adesão de ser humano

ENSG00000169504

nº de adesão NCBI

NM_013943

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CLIC4(25932) , CLIC4(25932)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qiu-Yun Yu et al.
Journal of cellular biochemistry, 119(1), 659-668 (2017-06-22)
This study explored the effects involved in silencing CLIC4 on apoptosis and proliferation of mouse liver cancer Hca-F and Hca-P cells. A CLIC4-target small interfering RNA (siRNA) was designed to compound into two individual complementary oligonucleotide chains. A process of
Baolong Wang et al.
Carcinogenesis, 41(6), 841-849 (2019-09-29)
Chloride intracellular channel protein 4 (CLIC4) has been implicated in different types of cancers, but the role of CLIC4 in the development of gastric cancer (GC) remains unknown. We analyzed the expression of CLIC4 in 102 pairs of gastric adenocarcinomas
Wei Guo et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 9049-9057 (2015-06-19)
A recent study reported that miR-570 was the most important microRNA in the microRNA gene networks of alcoholic liver disease that has the potential of progressing to hepatocellular carcinoma. However, litter is known regarding the expression and specific function of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica