Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU102911

Sigma-Aldrich

MISSION® esiRNA

targeting human RACK1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yi Hu et al.
Cancer letters, 450, 144-154 (2019-03-09)
Receptor of activated protein kinase C 1 (RACK1) is downregulated in gastric cancer and is involved in modulating NF-κB signaling pathway activity. However, the underlying molecular mechanisms regulating RACK1 expression are unclear. In this study, we demonstrated that downregulated expression
Lei Zhang et al.
OncoTargets and therapy, 12, 1007-1020 (2019-02-19)
The expression and function of the Receptor for Activated C Kinase 1 (RACK1) in cancer growth and metastasis are confused in different cancers, especially in pancreatic ductal adenocarcinoma (PDAC). One-hundred and eighty-two PDAC tissue specimens (95 males and 87 females)
Wenting He et al.
Journal of Alzheimer's disease : JAD, 75(2), 451-460 (2020-04-07)
Accumulation of amyloid-β (Aβ) peptides, generated from amyloid-β precursor protein (AβPP) amyloidogenic processing, is one of the most salient disease hallmarks of Alzheimer's disease (AD). Nicotine is able to promote α-secretase-mediated AβPP nonamyloidogenic processing and increase the release of sAβPPα
Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Sujata Jha et al.
Nature, 546(7660), 651-655 (2017-06-22)
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica