Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU095021

Sigma-Aldrich

MISSION® esiRNA

targeting human NELL1 (1)

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGCCGTGCATTTAAGTCAATGGTTGTTAAAAGAAGTTTCCCGTGTTGTAAATCATGTTTCCCTTATCAGATCATTTGCAAATACATTTAAATGATCTCATGGTAAATGTTGATGTATTTTTTGGTTTATTTTGTGTACTAACATAATAGAGAGAGACTCAGCTCCTTTTATTTATTTTGTTGATTTATGGATCAAATTCTAAAATAAAGTTGCCTGTTGTGACTTTTGTCCCATCTACTGCATACTTAGTGCTGAGATCCCTGTAAAATGTTTTGATGAAAATATGTATGTAGAGTCCAGTCGCATTATACATACATTTCATAGTGCTGAACCTTCTTAAATGCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Anthony Ambesi et al.
Journal of cell science, 127(Pt 17), 3805-3816 (2014-07-02)
The fibronectin matrix plays a crucial role in the regulation of angiogenesis during development, tissue repair and pathogenesis. Previous work has identified a fibronectin-derived homophilic binding peptide, anastellin, as an effective inhibitor of angiogenesis; however, its mechanism of action is
Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to
Hong-Bo Pang et al.
Nature communications, 5, 4904-4904 (2014-10-04)
Neuropilins (NRPs) are trans-membrane receptors involved in axon guidance and vascular development. Many growth factors and other signalling molecules bind to NRPs through a carboxy (C)-terminal, basic sequence motif (C-end Rule or CendR motif). Peptides with this motif (CendR peptides)

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica