Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU094851

Sigma-Aldrich

MISSION® esiRNA

targeting human APBB3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAGTGCCATGTGTTTTGCTGTGATGTCCCTGCCAAGGCCATTGCCAGTGCCCTACATGGGCTTTGTGCCCAGATCTTGTCAGAGCGAGTAGAGGTCAGTGGTGATGCCTCTTGCTGCTCCCCAGACCCCATCTCTCCTGAAGACCTGCCACGGCAAGTGGAGCTGCTGGATGCGGTAAGCCAAGCTGCTCAGAAGTACGAGGCACTGTATATGGGGACACTGCCAGTCACCAAGGCCATGGGCATGGATGTGCTGAACGAGGCCATTGGTACCCTCACCGCCAGGGGGGACCGGAATGCCTGGGTCCCCACCATGCTCAGTGTGTCTGACTCTCTCATGACTGCACACCC

Ensembl | Número de adesão de ser humano

ENSG00000113108

nº de adesão NCBI

NM_006051

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... APBB3(10307) , APBB3(10307)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Patompon Wongtrakoongate et al.
PLoS genetics, 11(10), e1005615-e1005615 (2015-10-27)
Long non-coding RNAs (lncRNAs) have been recognized as key players in transcriptional regulation. We show that the lncRNA steroid receptor RNA activator (SRA) participates in regulation through complex formation with trithorax group (TrxG) and polycomb repressive complex 2 (PRC2) complexes.

Questions

  1. What is the amount of 20 ug esiRNA in term mol?

    1 answer

    1. esiRNA is a pooled product with a variable molecular weight. The molecular weight can be estimated using the following information:
      - Calculation of esiRNA molar mass
      - A high percentage of the esiRNA pool is 21 bp
      - The average molar mass of one base including sugar and phosphate is 345 g/mol.
      - For an esiRNA (always double stranded) of 21 bp, the average molar mass can be calculated as follows: 2 x 21 x 345 = 14,490 g/mol

      For additional information please refer to the esiRNA technical bulletin in the link below:
      https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/786/318/cstesirnabul.pdf

      Helpful?

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica